DH5-Alpha cells of the pfFabG plasmid were midi-prepped and nanodropped for storage in the -20 degree Celsius freezer in confirmed plasmid storage. The results of the Chembridge library were also collected and the top 10 ligands were found.
Fig 56. Nanodrop of pfFabG plasmid midiprepped on 12/5
Table 1. Top 10 ligands from the 306 ligand Chembridge library screened.
Although these scores were higher than the ones from the control docking, they are still lower than the ideal range of 80-100 that we would be looking for an effective ligand to test in assays. The protein structure was not very good and a better crystal structure needs to be found or a homology model made before more screening can be done. Week of 11/25/13-11/29/13:
Thanksgiving Break! Week of 11/18/13-11/22/13
An enzyme assay protocol for pfFabG was carried out. This was an inital enzyme assay and was a check to make sure the protein was functional. A library screening of the pfGR target was also carried on the the 306 ligand chembridge library.
The above shows the UV spectrum of only the buffer, water, and Acetyl CoA reagents.
The above graph shows only the buffer, water, and NADPH reagents. Although not shown in this figure, it should be noted that at 340 nm the absorbance is 0.112 which is the absorbance of NADPH.
Erroes in both of the above two graphs could include not allowing the reagents enough time to reach equilibrium before spectroscopy.
The graph above includes all reagents with the NADPH and FabG enzyme being added in during the data collection.
The first peak shows the addition of NADPH. It should be noted that additional NADPH was added because with the cuvette already inserted it was difficult to determine if the small amount of reagent was added to the mix. The second peak shows the addition of pfFabG. In future enzyme assays, more enzyme should be added to bring down the absorbance more.
Week of 11/11/13-11/16/13
On Monday, protein characterization was done. The gel was run and then washed and stained and allowed to de-stain overnight. Elution one was concentrated and stored in snap-freeze and glycerol. The next day, the gel was taken out and found to have a large tear in it so it was not dried but a preliminary picture was taken.
Fig 53. Poly-acrylamide gel of pfFabG protein characterization.
Control Docking rankings for pfGR.
Week of 11/4/13-11/9/13
The control docking was resubmitted because it failed to run, may have been booted. On Tuesday morning, small liquid cultures (10 X 4ml LB) were inoculated with pfFabG and incubated for 8 hours. The large-culture step was done that evening and incubated for 18 hours at room temperature. The incubated liquid culture was then spun down using the JA-10 rotor in two 500 ml cylindrical bottles on Wednesday afternoon. The samples were re suspended in lysis buffer and stored in the -80 degree Celsius freezer. On Friday, cell lysis was done by sonication and the sonicated samples were spun down, the supernatant was retained and then clarified by filtration. On Saturday morning, the Ni-NTA and His-tag purification protocol was followed out on the sample and both elutions were analyzed with Nanodrop spectroscopy. All samples were stored in the 4 degree Celsius freezer.
Table 1. Starter culture added and OD readings of large culture before induction.
Fig 50. Nanodrop spectroscopy of elution 1 from 11/9 protein purification of pfFabG.
Fig 51. Nanodrop spectroscopy of elution 2 from 11/9 protein purification of pfFabG.
Week of 10/28/13-11/1/13 Good work Alyssa! Try to include more analysis of your procedures and results. -Suman 11/4/13
The plates were master plated and liquid cultures were grown over night. The next day no growth was seen in the master plate or liquid culture, so the bacteria were not viable after the long incubation. Virtual screening was done and NADP and GSH were docked into the 1ONF crystal structure and a control docking was run. I switched to work on the FabG target with Melissa. lB media was made and autoclaved and a master plate and small liquid culture were made of the validated DH5-alpha colony to make more plasmid later for future transformations. The control docking job was also resubmitted because it got dropped the first time.
Fig 48. Master plate of pfFabG after overnight incubation.
Fig 49. pfFabG overnnigh culture after 16 hour incubation.
Fig 50. Liquid culture after being spun down for 10 minutes, 5,000 rpm, and 4 degrees celsius.
Positive Controls for pfGR
Compound
IC50
Mol. Weight
LogP
H Donor
H Acceptor
GSHoriginal
Original
307.3
-4.5
6
8
573747pos1
40 nM
306.3
3.4
0
7
45484010pos2
63 nM
221.1
1.7
0
6
10352496pos3
110 nM
190.1
1.5
0
4
44626409pos4
350 nM
302.2
1.2
0
9
45484014pos5
400 nM
302.2
1.2
0
9
25270070pos6
480 nM
314.1
1.6
0
9
5325382pos7
630 nM
206.1
2.1
1
5
651069pos8
4500 nM
289.3
1.1
1
4
Negative Controls for pfGR
Compound
Mol. Weight
LogP
H-donor
H-acceptor
2244 (aspirin)
180.1
1.2
1
4
40648952neg1
290.3
.3
3
4
3082400neg2
303.3
-8.2
5
9
440634neg3
303.3
-8.2
5
9
1598670neg4
290.2
-1.8
4
4
Week of 10/21/13-10/26/13 The gel extraction protocol was performed on the below gel. The concentration on this gel was very low, so another secondary PCR was done, as well as a PCR squared. 300 microliters of the PCR squared sample was run on a gel and gel extracted. This DNA sample was used as the PCR insert for transformation along with the pNIC vector cut on October 16th. Transformation was done and plates were checked the next afternoon with no growoth. There was no growth the next morning as well. A day and a half later, colonies were present and stored in the four degree fridge for the master plate protocol.
Fig 47. Nanodrop reading from PCR gel ran in the previous week. No more saving gels in freezer.
Fig 46. Gel extracted from on 10/23. All lanes contain PCR squared samples.
Fig 45. Nanodrop reading of gelextraction performed on October 23rd.
Fig 44. pfGR Plate A after incubation.
Fig 43. pfGR Plate B after incubation.
Week of 10/14/13-10/19/13
Nice work on keeping the gel extraction data posted. Good captions and analysis. Try to include your gene size on the gel captions. Do you have any virtual data? Thank you. -Max 10/21/13
Gel extraction of the PCR squared sample from last week was done. The concentration of this gel extraction was low and the previous cut pNic vector was not digested fully, so more of each was made. pNIC digestion was successful, but two PCR squared protocols resulted in primer dimers. The primers were rediluted from the original stocks to resolve this problem. The gel was hen cut and stored for gel extraction.
Fig 42. Agarose of PCR sqaured; Ln 1. 1 kb ladder, remaining lanes are PCR squared sample.
This gel was extracted despite primer dimers, because they would not be included in the gel extraction protocol anyways.
The concentration on the above gel extraction was very low, so more sample needed to be made and gel extracted again.
The below two gels are from two separate PCR squared samples that were both run.
Fig 43. Agarose gel of PCR squared sample. Ln 1. 1 kb ladder, remaining lanes are PCR squared.
This gel resulted in primer dimers which with very little existence of the target gene present.
Fig 44. Agarose gel of PCR squared sample found in box. Ln 1. 1 kb ladder; Ln 2. cut pNIC; remaining lanes are PCR sqaured.
The pNIC in this gel is shown to be digested more fully but the PCR sample is not the correct length of 1500 bp.
This is the Nanodrop of the cut pNIC. Purity looks good.
Fig 45. Agarose gel of PCR squared sample. Ln 1. 1 kb ladder; remaning lanes are PCR squared.
Another PCR squared was run with the same primers but newly diluted dNTP, so the problem was reasoned to be the primers which were diluted again in the next gel.
Fig 46. Agarose gel of PCR squared sample. Lane 1: kb ladder; remaning lanes are PCR squared.
This was PCR squared with the new diluted primers, some dimers still present, but will be cut out anyways so only the target gene will be in the gel extraction.
Week of 10/7/13-10/11/13
Another secondary PCR was done from the Primary max sample. The next day the secondary PCR sample and a PCR squared sample was ran to confirm them before moving on to gel extraction.
Fig 41. Agarose gel of secondary PCR and PCR squared of pfGR.
Lane 1: 1 kb ladder
Lane 2: Secondary PCR at 63 °C annealing temp
Lane 3: PCR squared sample
Both sample are good for further use in cloning. The secondary PCR sample will be saved if more PCR squared sample needs to be made in the future and gel extraction will be done on the remaining PCR squared sample.
Week of 9/30/13-10/4/13
Nice captions and brief analyses. Keep up the good work. -Max 10/07/2013
Clone results came back again with no significant match for colony one. Another gel extraction was done along with cutting of more pNIC-Bsa4 vector. The concentration on the gel extraction was very low, so another secondary PCR and PCR squared were made in preparation for another gel extraction protocol.
Fig 40. PCR samples of primary PCR, Secondary PCR , and PCR squared. The cut pNIC-Bsa4 vector was also run on the gel.
Lane 1: 1 Kb ladder Lane 2: Primary PCR Lane 3: Secondary PCR (@ 63 degree annealing temp) Lane 4: PCR squared Lane 5: nothing Lane 6: Cut pNIC
The primary looked good, but secondary and PCR squared were not bright or definite enough. Another run of secondary and PCR squared will have to be done to produce a good enough sample for gel extraction and then go into cloning again.
Sequencing results for Colony 1 with no significant similarities to our gene.
Fig 39. Agarose gel of samples Lm and Mm with a 1 kb ladder for gel extraction.
Fig 40. Nanodrop results of gel extraction sample from above.
Concentrations of this DNA sample are too low. Secondary and PCR squared will be done again to create more sample for another gel extraction.
Fig 41. Nanodrop results for cut pNIC-Bsa4 vector.
Week of 9/23/13-9/28/13 Sequence results for colony 1 came back and after a pairwise alignment with the PfGR codon optimized gene sequence, it was found to have no similarity. Closer analysis of the sequence results shows that many of the nucleotides were not able to be determined. The cohesive end generation and transformation process was repeated with the new gel extraction sample from last week. Two more sequencing samples from colony 1 were sent (one with forward primer, one with reverse primer) to see if better results could be received. After 2 days in the incubator, no colonies were present on plate A or B from this week's round of cloning.
For next week: Because the 2 V: 8 I ratio has not been successful, a higher ratio (possibly 1 V: 9 I) will be used for the next round of cloning.
Virtual Screening Set-up
1ONF: Plasmodium falciparum glutathione reductase; FAD only (cofactor, not localized in same vicinity as NAD)
3SQP: Human homology model with antimalarial agent bound; 40% identity, align well in PyMol
1GEU: E.coli; has FAD and NAD; *use this to define NADPH binding site*
1GET: E.coli; FAD and NADPH; NADPH and FAD in another chain when aligned
4G0L: E.coli glutathione-hydroquinone reductase; glutathione is bound; not aligned well
3R3E: E.coli glutathione transferase;glutathione bound; not aligned well
2HQM: Yeast glutathione reductase; glutathione bound and matches up well, but glutathione doesn't seem to be in active site
2GRT: Human glutathione reductase, aligns well, NAD and Fad line up, FAD lines up with GEU, GDS not close enough
1DNC: Human Glutathione Reductase, aligns well, FAD aligns with 1ONF and 1GEU, GSH not close enough to active site
1GRA: Glutathione Reductase, aligns well, FAD aligns, NDP does not, GSH not close enough
1GRE: aligns well, FAD aligns, GSH not close to active site, 16 polar contacts
1GSN: aligns well, FAD aligns, GSH is close to active site, 8 polar contacts
3DK4: aligns well, FAD aligns, GSH similar to 1GSN (accept has 2 ligands), 18 polar contacts
3DK8: aligns well, FAD aligns, same GSH binding as 3DK8, 15 polar contacts
To-Do: Look at mitochondrial GRs Dock NADPH into 1ONF from 1GEU Find protein for glutathione docking
Fig 38. Active site of 1ONF with 1GEU and 3DK4 aligned. the ligand in yellow is NAD from the 1GEU protein, the orange ligand is NDP from 3DK4, the red ligands are FAD from each of the three proteins, and the dark blue residue is GSH from 3DK4 with polar contacts shown in black (18).
Week 3 & 4 9-Sep - 22-Sep Alyssa - ok - you need to keep pushing the cloning forward. We want to get you onto protein work soon. Get set up to try multiple rounds of cloning and always make extra materials (PCRsquared and pNIC-bsa4 - so that you don't have to go back 2 steps each time) - Dr. B 100113 - use stephanie to make back up materials!
Week of 9/16/13-9/20/13 On Monday, the first day of cloning was done. DH5-Alpha cells were transformed with the pNIC-Bsa4 which was inserted with our PCR insert. Tube A was done with 2µl of accepting vector with 8µl of PCR insert. Tube B had 1µl of accepting vector with 7µl of PCR insert. The transformations were plated and incubated overnight. Plate A had only one colony after one night of incubation and Plate B had none, so both plates were incubated for another night. After two nights of incubation, only one colony was able to be collected (the same one from plate A). Colony 1 from plate A was incubated over night in an LB culture and spun down the next morning. A sample for colony 1 was prepared and sent off to sequencing. Another gel extraction was done so more DNA sample would be ready for cloning the next week.
Fig 37. Nanodrop of gel extraction from 9/20/13.
The purity and concentration of this DNA sample from the gel extraction on 9/20/13 are both within a good range. However, the contamination reading (260/230) is fairly low. It should be
around 2.1. This could possibly be due to residues added to the sample from the gel extraction kit.
Fig 36. Plate A with one colony present after two day incubation.
Fig 37. Plate B shown with no colonies, however there were some small ones, but too small to be seen in this picture.
Week of 09/9/13-9/13/13 PCR squared was done again on secondary sample Hm. All samples were then run on an agarose gel and gel extraction was done. The DNA sample was split into 10 collection tubes after gel extraction. PCR cleanup on the 10 samples was done to combine them into 2 more highly concentrated samples. These samples were however fairly low. Later another gel extraction was done on the remaining 3 PCR squared samples. Then another PCR cleanup was done with the three samples to get one concentrated samples of DNA. Two more PCR squared samples were made in case more DNA sample was needed.
Fig 35. Nanodrop of PCR Cleanup sample from all combined gel extractions.
After receiving this suitable concentration of DNA sample (that we know is all our gene because of gel extraction) we will move on into cutting PNic-BSA4 and cohesive end generation and transformation next week.
Fig 34. PCR squared gel used for second gel extraction. Only the bands in lanes 2, 3, and 6 were extracted.
Fig 33. Nanodrop of PCR Cleanup 2 from first gel extraction.
Fig 32. Nanodrop of PCR cleanup 1 of first gel extraction.
Fig 31. PCR squared of sample Hm. 200 microliters of total sample run. Every lane is the same PCR squared sample.
Week of 9/2/13-9/6/13 Sequencing results for clones were analyzed. Sequence results both forward and reverse were no more than 30-40 bp long. A smaller DNA piece must have attached and cloned instead of the target gene. To solve this problem, another PCR gel will be run and then gel extracted.
Week 9 Mini-prep was done on the 16 samples and they were prepped for sequencing.
Fig 31. Concentrations and dilution calculations for sequencing for all 16 samples from colonies on plates C and D.
Samples C1, C2, C3, C4, C5, and C8 were chosen based on purity to be sequenced with both forward primers and reverse primers, so in total 12 samples were initially sequenced.
Week 8 PCR squared was done on the Hm sample with and annealing temperature of 63°C. pNIC-Bsa4 was cut with BSAI-HF and cohesive end generation was done on both the PCR insert and the accepting pNIC vector. Transformation was completed and the first set of plates did not grow any colonies. The next day another transformation was done with the previous vector and PCR insert that had cohesive end generation done and with new samples with cohesive end generation. The plates with the second cohesive end generation done to them produced colonies and eight colonies from each plate (plate C and D) so a total of 16 samples were used for the two master plates and the small cultures. The cultures were spun down and put in the freezer for mini-prep next week.
Fig 30. Master plates of 8 colonies from both Plate C and Plate D before incubation.
Fig 29. The top two plates are the second attempt at samples A and B which did not grow colonies again. The bottom two plates are C and D which were done with new cohesive end transformation.
Fig 28. The first attempt at samples A and B from cloning.
Week 7 Sequencing results came back from the pNIC-Bsa4 plasmid made last week and were analyzed. Secondary PCR overlap of the oligos for PfGR was redone with a range of temperatures to find the optimal annealing temperature with both first and last oligos and tail primers. Another secondary PCR with a higher range of temperatures were done the next day. The next day two gradients were done on a secondary PCR with a new oligo mix made with tris base and a new primary. Successful secondary PCR was done by doing 30 second annealing and extension times for both the primary and secondary.
Fig 27. Successful secondary PCR with 30 second annealing and extension times for both the secondaries and the primary.
Lane 1: 1 Kb ladder Lane 2: Max Primary Lane 3: Hm (63°C) Lane 4: Im (63.6°C) Lane 5: Jm (64.6°C) Lane 6: Km (66.2°C) Lane 7: Lm (68.1°C) Lane 8: Mm (69.7°C) Lane 9: Nm (70.6°C) Lane 10: Om (71.0°C)
Fig 26. Ran another primary to confirm it, and re-ran the PCR squared sample with the previous secondary samples that worked (D,E,F,G), re ran secondary samples at the same temperatures.
Lane 1: 1 Kb ladder Lane 2: primary Lane 3: PCR squared Lane 4: B° (62.7 °C) Lane 5: C° (63.2°C) Lane 6: D° (63.9°C) Lane 7: E° (64.7°C) Lane 8: F° (65.4°C) Lane 9: G° (65.8°C) Lane 10: nothing
Fig 25. Secondary PCR with lower temperature gradient also made with the new primary with new oligo mix.
Lane 1: 1 Kb ladder Lane 2: I (62°C) Lane 3: J (61.8°C) Lane 4: K (61.4°C) Lane 5: L (60.6°C) Lane 6: M (59.6°C) Lane 7: N (58.8°C) Lane 8: O (58.3°C) Lane 9: P (58.0°C) Lane 10: nothing
Fig 24. Another secondary PCR done with a higher temperature gradient made with primary from new oligo mix.
Lane 1: 1 Kb ladder Lane 2: Q- (72°C) Lane 3: R- (71.8°C) Lane 4: S- (71.4°C) Lane 5: T- (70.6°C) Lane 6: U- (69.6°C) Lane 7: V- (68.8°C) Lane 8: W- (68.3°C) Lane 9: X- (68.0°C) Lane 10: Primary
Fig 23. Sixth attempt at secondary PCR.
Lane 1: 1 Kb ladder Lane 2: Sample S (65°C) Lane 3: Sample T (65.2°C) Lane 4: Sample U (65.7°C) Lane 5: Sample V (66.4°C) Lane 6: Sample W (67.2°C) Lane 7: Sample X (67.9°C) Lane 8: Sample Y (68.3°C) Lane 9: Sample Z (68.5°C) Lane 10: Sample A^2 (PCR squared with samples D, E, F, G, from below)
Fig 22. Secondary PCR overlap done with tail primers.
Gene is ~1500 bp Lane 1: Sample A (62.5 °C) Lane 2: Sample B (62.7 °C) Lane 3: Sample C (63.2 °C) Lane 4: Sample D (63.9 °C) Lane 5: Sample E (64.7 °C) Lane 6: Sample F (65.4 °C) Lane 7: Sample G (65.8 °C) Lane 8: Sample H (66 °C) Lane 9: 1 Kb ladder
Fig 23. Secondary PCR overlap done with first and last oligos.
Pairwise Alignment with pNIC-Bsa4 Week 6 The secondary PCR overlap protocol was finished and the samples were prepped and run on an agarose gel the next day for analysis. FPLC of the PfDXR protein was done for further purification of this protein. VS4 was redone again, but this time CONECTs between the metals and other residues were removed. Midi prep of the pNIC-Bsa4 protein was also done and the sample's concentration was determined by Nanodrop and was sent to sequencing. Two more secondary PCRs were done, one with first and last oligos, the seconds with tail primers. Both of these were also run on a gel. The protein samples recovered from the FPLC of PfDXR were spun down and filtered and then analyzed with Nanodrop. The proteins were then stored by both flash freeze and glycerol methods.
Fig 21. Lane 1 contained 1Kb ladder; Lane 2: secondary PCR of pFGR with 63 degrees Celcius annealing temperature.
The below gel shows the secondary PCR of PfGR done with an annealing temperature of 64 degrees Celsius, the above is at 63 degrees Celsius. The next attempt will be done at 64 degrees since the below image shows some amplification at the appropriate bp length (about 1500 bp).
Fig 20. Agarose gel of secondary PCR samples. Lane 2: 1 kb ladder; Lane 3: secondary PCR with first and last oligos; Lane 4: secondary PCR with tail primers; Lane 5: 1 kb ladder.
Fig 19. Spectrometer results of midiprepped pNIC-Bsa4 plasmid on Nanodrop.
Fig 18. PCR overlap can be found on the right side of the gel. The primary PCR smear is visible, but no the secondary sample.
Week 5 Primer design of the tail primers for our specific targets were done and put on the wish-list for ordering. Then primers for our targets were diluted and stored to run a gel on later. Another culture of pNIC-Bsa4 was grown overnight and spun down and saved in the -20 freezer for midi prep to be done to it later. An oligo mix was made from the 38 primers for the 3D7 glutathione reductase target. From the oligo mix a PCR overlap protocol was done and an agarose gel was run from the primary and secondary samples. The primary sample could be made out on the gel. but not the secondary sample so another primary and secondary PCR overlap was made, as well as another secondary sample from the initial primary sample.
Fig 17. On the right side of the gel are the initial PCR overlap primary and secondary samples.
Week 4 Analysis of DNA sequencing of pGBR22 was done in the computer lab in which the forward and reverse primers were determined, as well as the location of the start and stop codon of the specified plasmid and the vector backbone. SDS-Page protein gels were prepared Tuesday for later use on our purified protein. pfDXR protein samples from last week's protein expression were sonicated and then purified. Both elution samples were then analyzed on the Nanodrop spectrometer. The next morning the samples taken from protein purification of pfDXR were run on the SDS-Page protein gel made earlier in the week and was washed and stained. An agarose gel from the pLIC PCR that was redone last week was redone. After washing overnight, the SDS-Page gel was dried for analysis. Restriction enzyme digest was also done and an agarose gel was done for analysis.
Fig 16. Restriction Enzyme digest gel; Lane 1: 1 kb ladder; Lane 2: uncut plasmid; Lane 3: EcoRI; Lane 4: PvuII; Lane 5: EcoRI and PvuII.
Fig 14. SDS-Page gel of pfDXR before drying the gel.
Fig 15. SDS-Page gel of pfDXR after drying the gel.
Fig 13. Second agarose gel fpr pLIC PCR.
Fig 12. Nanodrop of elution 1 sample from purification of pfDXR protein.
Fig 11. Nanodrop of elution 2 sample from purification of pfDXR protein.
Week 3 The PCR of the GFP sample done last week was run on a gel and imaged for analysis. The results from the DNA sequencing of the midi-prepped pNIC-Bsa4 sample were also returned and analyzed. Then two small overnight cultures of BL21(DE3) with FABV plasmid (100 ml LB each) were prepared and left in the shaking incubator overnight. A larger LB flask (500 ml LB) was also prepared to transfer the small culture over the next morning. The next morning the FABV bacteria did not have any growth so protein expression was continued with the pfDXR culture. 30 ml of the pfDXR culture was transferred to a larger culture was checked every 30 minutes until it reach an OD 600 of 0.500 (reached 0.995) and then left in the shaking incubator for approximately 3.5 hours. This culture was then spun down and re-suspended in buffer to be stored in the -80 degrees Celsius freezer. PCR of pNIC-Bsa4 plasmid was done with pLIC primers and the samples were run on an agarose gel and imaged for analysis.
Fig 10. Agarose gel of PCR samples of pNIC-Bsa4 plasmid with pLIC primers. Lane 1: 100 bp ladder. Samples not seen and PCR must be redone. PNIC-Bsa4 plasmid used had a concentration of 19.6 ng/ul.
Fig 9. Agarose gel of GFP PCR samples with samples containing VDS1 and VDS2 on the left and sample containing M13 Forward and M13 Reverse primers on the right. Lane 1: 100 bp ladder; Lane 2: sample 1; Lane 3: sample 2; Lane 4: sample 3; Lane 5: sample 4; Lane 6: 100 bp ladder; Lane 7: sample 5; Lane 8: sample 6; Lane 9: sample 7; Lane 10: sample 8.
Blast Results for above sequence The above confirmed the indentity of the pNIC-Bsa4 plasmid and it was transfered to the plasmid box.
Week 2 - A - great work and great page! -- Dr. B Midi Prep was done on the pNic-BSA4 plasmid sample that was made from the overnight culture last week. Agarose gels of last week's PCR samples were made and analyzed. The first midi prep did not produce a successful sample, so a second culture was made and spun down for a second midi prep to be done. The sample collected from the midi prep was then analyzed using the Nanodrop spectrometer and found to have a concentration of 19.6 ng/ul. A second PCR was done using VDS 1 and 2 primers as well as M13 forward and reverse primers on the GFP plasmid.
Fig 6. Agarose gel of pGBR22 plasmid. First 5 lanes on left are mine, the second 5 on the right are Will's. Lane 1: ladder; Lane 2: sample A; Lane 3: sample B; Lane 4: sample C; Lane 5: sample D.
Fig 7. Absorbance reading at 260 nm of sample 1 of pNic-BSA4 plasmid.
Fig 8. Absorbance reading at 260 nm of sample 2 of pNic-BSA4 plasmid.
Week 1 Primer T7 was diluted to a 10uM concentration. DNA sequencing of pGBR22 plasmid was also done and the results came back with an exact match for the chromoprotein. E.coli cells were transformed with pNic-BSa4 plasmid, and overnight culture was made, and that culture was then spun down and stored for the midi prep protocol. PCR was also done to the same pGBR22 plasmid and the samples were stored in the freezer.
Transformation
Fig 3. LB agar plate with kanamycin with colonies of pNic-BSa4 E.coli. 25 ng of plasmid added and 245 colonies counted.
Fig 4. Lb agar plate with kanamycin with colonies of pNic-BSa4 E.coli. 5 ng of plasmid added and 152 colonies counted.
Fig 5. LB agar plate with kanamycin and colonies of pNic-BSa4 E. coli. 25 ng of plasmid added and 83 colonies counted.
DH5-Alpha cells of the pfFabG plasmid were midi-prepped and nanodropped for storage in the -20 degree Celsius freezer in confirmed plasmid storage. The results of the Chembridge library were also collected and the top 10 ligands were found.
Table 1. Top 10 ligands from the 306 ligand Chembridge library screened.
Although these scores were higher than the ones from the control docking, they are still lower than the ideal range of 80-100 that we would be looking for an effective ligand to test in assays. The protein structure was not very good and a better crystal structure needs to be found or a homology model made before more screening can be done.
Week of 11/25/13-11/29/13:
Thanksgiving Break!
Week of 11/18/13-11/22/13
An enzyme assay protocol for pfFabG was carried out. This was an inital enzyme assay and was a check to make sure the protein was functional. A library screening of the pfGR target was also carried on the the 306 ligand chembridge library.
The above shows the UV spectrum of only the buffer, water, and Acetyl CoA reagents.
The above graph shows only the buffer, water, and NADPH reagents. Although not shown in this figure, it should be noted that at 340 nm the absorbance is 0.112 which is the absorbance of NADPH.
Erroes in both of the above two graphs could include not allowing the reagents enough time to reach equilibrium before spectroscopy.
The graph above includes all reagents with the NADPH and FabG enzyme being added in during the data collection.
The first peak shows the addition of NADPH. It should be noted that additional NADPH was added because with the cuvette already inserted it was difficult to determine if the small amount of reagent was added to the mix. The second peak shows the addition of pfFabG. In future enzyme assays, more enzyme should be added to bring down the absorbance more.
Week of 11/11/13-11/16/13
On Monday, protein characterization was done. The gel was run and then washed and stained and allowed to de-stain overnight. Elution one was concentrated and stored in snap-freeze and glycerol. The next day, the gel was taken out and found to have a large tear in it so it was not dried but a preliminary picture was taken.
Control Docking rankings for pfGR.
Week of 11/4/13-11/9/13
The control docking was resubmitted because it failed to run, may have been booted. On Tuesday morning, small liquid cultures (10 X 4ml LB) were inoculated with pfFabG and incubated for 8 hours. The large-culture step was done that evening and incubated for 18 hours at room temperature. The incubated liquid culture was then spun down using the JA-10 rotor in two 500 ml cylindrical bottles on Wednesday afternoon. The samples were re suspended in lysis buffer and stored in the -80 degree Celsius freezer. On Friday, cell lysis was done by sonication and the sonicated samples were spun down, the supernatant was retained and then clarified by filtration. On Saturday morning, the Ni-NTA and His-tag purification protocol was followed out on the sample and both elutions were analyzed with Nanodrop spectroscopy. All samples were stored in the 4 degree Celsius freezer.
Table 1. Starter culture added and OD readings of large culture before induction.
Week of 10/28/13-11/1/13
Good work Alyssa! Try to include more analysis of your procedures and results. -Suman 11/4/13
The plates were master plated and liquid cultures were grown over night. The next day no growth was seen in the master plate or liquid culture, so the bacteria were not viable after the long incubation. Virtual screening was done and NADP and GSH were docked into the 1ONF crystal structure and a control docking was run. I switched to work on the FabG target with Melissa. lB media was made and autoclaved and a master plate and small liquid culture were made of the validated DH5-alpha colony to make more plasmid later for future transformations. The control docking job was also resubmitted because it got dropped the first time.
Positive Controls for pfGR
Week of 10/21/13-10/26/13
The gel extraction protocol was performed on the below gel. The concentration on this gel was very low, so another secondary PCR was done, as well as a PCR squared. 300 microliters of the PCR squared sample was run on a gel and gel extracted. This DNA sample was used as the PCR insert for transformation along with the pNIC vector cut on October 16th. Transformation was done and plates were checked the next afternoon with no growoth. There was no growth the next morning as well. A day and a half later, colonies were present and stored in the four degree fridge for the master plate protocol.
Week of 10/14/13-10/19/13
- Nice work on keeping the gel extraction data posted. Good captions and analysis. Try to include your gene size on the gel captions. Do you have any virtual data? Thank you. -Max 10/21/13
Gel extraction of the PCR squared sample from last week was done. The concentration of this gel extraction was low and the previous cut pNic vector was not digested fully, so more of each was made. pNIC digestion was successful, but two PCR squared protocols resulted in primer dimers. The primers were rediluted from the original stocks to resolve this problem. The gel was hen cut and stored for gel extraction.This gel was extracted despite primer dimers, because they would not be included in the gel extraction protocol anyways.
The concentration on the above gel extraction was very low, so more sample needed to be made and gel extracted again.
The below two gels are from two separate PCR squared samples that were both run.
This gel resulted in primer dimers which with very little existence of the target gene present.
The pNIC in this gel is shown to be digested more fully but the PCR sample is not the correct length of 1500 bp.
This is the Nanodrop of the cut pNIC. Purity looks good.
Another PCR squared was run with the same primers but newly diluted dNTP, so the problem was reasoned to be the primers which were diluted again in the next gel.
This was PCR squared with the new diluted primers, some dimers still present, but will be cut out anyways so only the target gene will be in the gel extraction.
Week of 10/7/13-10/11/13
Another secondary PCR was done from the Primary max sample. The next day the secondary PCR sample and a PCR squared sample was ran to confirm them before moving on to gel extraction.
Lane 1: 1 kb ladder
Lane 2: Secondary PCR at 63 °C annealing temp
Lane 3: PCR squared sample
Both sample are good for further use in cloning. The secondary PCR sample will be saved if more PCR squared sample needs to be made in the future and gel extraction will be done on the remaining PCR squared sample.
Week of 9/30/13-10/4/13
- Nice captions and brief analyses. Keep up the good work. -Max 10/07/2013
Clone results came back again with no significant match for colony one. Another gel extraction was done along with cutting of more pNIC-Bsa4 vector. The concentration on the gel extraction was very low, so another secondary PCR and PCR squared were made in preparation for another gel extraction protocol.Lane 1: 1 Kb ladder
Lane 2: Primary PCR
Lane 3: Secondary PCR (@ 63 degree annealing temp)
Lane 4: PCR squared
Lane 5: nothing
Lane 6: Cut pNIC
The primary looked good, but secondary and PCR squared were not bright or definite enough. Another run of secondary and PCR squared will have to be done to produce a good enough sample for gel extraction and then go into cloning again.
Sequencing results for Colony 1 with no significant similarities to our gene.
Concentrations of this DNA sample are too low. Secondary and PCR squared will be done again to create more sample for another gel extraction.
Week of 9/23/13-9/28/13
Sequence results for colony 1 came back and after a pairwise alignment with the PfGR codon optimized gene sequence, it was found to have no similarity. Closer analysis of the sequence results shows that many of the nucleotides were not able to be determined. The cohesive end generation and transformation process was repeated with the new gel extraction sample from last week. Two more sequencing samples from colony 1 were sent (one with forward primer, one with reverse primer) to see if better results could be received. After 2 days in the incubator, no colonies were present on plate A or B from this week's round of cloning.
For next week: Because the 2 V: 8 I ratio has not been successful, a higher ratio (possibly 1 V: 9 I) will be used for the next round of cloning.
Virtual Screening Set-up
1ONF: Plasmodium falciparum glutathione reductase; FAD only (cofactor, not localized in same vicinity as NAD)
3SQP: Human homology model with antimalarial agent bound; 40% identity, align well in PyMol
1GEU: E.coli; has FAD and NAD; *use this to define NADPH binding site*
1GET: E.coli; FAD and NADPH; NADPH and FAD in another chain when aligned
4G0L: E.coli glutathione-hydroquinone reductase; glutathione is bound; not aligned well
3R3E: E.coli glutathione transferase;glutathione bound; not aligned well
2HQM: Yeast glutathione reductase; glutathione bound and matches up well, but glutathione doesn't seem to be in active site
2GRT: Human glutathione reductase, aligns well, NAD and Fad line up, FAD lines up with GEU, GDS not close enough
1DNC: Human Glutathione Reductase, aligns well, FAD aligns with 1ONF and 1GEU, GSH not close enough to active site
1GRA: Glutathione Reductase, aligns well, FAD aligns, NDP does not, GSH not close enough
1GRE: aligns well, FAD aligns, GSH not close to active site, 16 polar contacts
1GSN: aligns well, FAD aligns, GSH is close to active site, 8 polar contacts
3DK4: aligns well, FAD aligns, GSH similar to 1GSN (accept has 2 ligands), 18 polar contacts
3DK8: aligns well, FAD aligns, same GSH binding as 3DK8, 15 polar contacts
To-Do:
Look at mitochondrial GRs
Dock NADPH into 1ONF from 1GEU
Find protein for glutathione docking
Sequence Results from Colony 1
Week 3 & 4 9-Sep - 22-Sep
Alyssa - ok - you need to keep pushing the cloning forward. We want to get you onto protein work soon. Get set up to try multiple rounds of cloning and always make extra materials (PCRsquared and pNIC-bsa4 - so that you don't have to go back 2 steps each time) - Dr. B 100113
- use stephanie to make back up materials!
Week of 9/16/13-9/20/13
On Monday, the first day of cloning was done. DH5-Alpha cells were transformed with the pNIC-Bsa4 which was inserted with our PCR insert. Tube A was done with 2µl of accepting vector with 8µl of PCR insert. Tube B had 1µl of accepting vector with 7µl of PCR insert. The transformations were plated and incubated overnight. Plate A had only one colony after one night of incubation and Plate B had none, so both plates were incubated for another night. After two nights of incubation, only one colony was able to be collected (the same one from plate A). Colony 1 from plate A was incubated over night in an LB culture and spun down the next morning. A sample for colony 1 was prepared and sent off to sequencing. Another gel extraction was done so more DNA sample would be ready for cloning the next week.
The purity and concentration of this DNA sample from the gel extraction on 9/20/13 are both within a good range. However, the contamination reading (260/230) is fairly low. It should be
around 2.1. This could possibly be due to residues added to the sample from the gel extraction kit.
Week of 09/9/13-9/13/13
PCR squared was done again on secondary sample Hm. All samples were then run on an agarose gel and gel extraction was done. The DNA sample was split into 10 collection tubes after gel extraction. PCR cleanup on the 10 samples was done to combine them into 2 more highly concentrated samples. These samples were however fairly low. Later another gel extraction was done on the remaining 3 PCR squared samples. Then another PCR cleanup was done with the three samples to get one concentrated samples of DNA. Two more PCR squared samples were made in case more DNA sample was needed.
After receiving this suitable concentration of DNA sample (that we know is all our gene because of gel extraction) we will move on into cutting PNic-BSA4 and cohesive end generation and transformation next week.
Week of 9/2/13-9/6/13
Sequencing results for clones were analyzed. Sequence results both forward and reverse were no more than 30-40 bp long. A smaller DNA piece must have attached and cloned instead of the target gene. To solve this problem, another PCR gel will be run and then gel extracted.
Week 9
Mini-prep was done on the 16 samples and they were prepped for sequencing.
Samples C1, C2, C3, C4, C5, and C8 were chosen based on purity to be sequenced with both forward primers and reverse primers, so in total 12 samples were initially sequenced.
Week 8
PCR squared was done on the Hm sample with and annealing temperature of 63°C. pNIC-Bsa4 was cut with BSAI-HF and cohesive end generation was done on both the PCR insert and the accepting pNIC vector. Transformation was completed and the first set of plates did not grow any colonies. The next day another transformation was done with the previous vector and PCR insert that had cohesive end generation done and with new samples with cohesive end generation. The plates with the second cohesive end generation done to them produced colonies and eight colonies from each plate (plate C and D) so a total of 16 samples were used for the two master plates and the small cultures. The cultures were spun down and put in the freezer for mini-prep next week.
Week 7
Sequencing results came back from the pNIC-Bsa4 plasmid made last week and were analyzed. Secondary PCR overlap of the oligos for PfGR was redone with a range of temperatures to find the optimal annealing temperature with both first and last oligos and tail primers. Another secondary PCR with a higher range of temperatures were done the next day. The next day two gradients were done on a secondary PCR with a new oligo mix made with tris base and a new primary. Successful secondary PCR was done by doing 30 second annealing and extension times for both the primary and secondary.
Lane 1: 1 Kb ladder
Lane 2: Max Primary
Lane 3: Hm (63°C)
Lane 4: Im (63.6°C)
Lane 5: Jm (64.6°C)
Lane 6: Km (66.2°C)
Lane 7: Lm (68.1°C)
Lane 8: Mm (69.7°C)
Lane 9: Nm (70.6°C)
Lane 10: Om (71.0°C)
Lane 1: 1 Kb ladder
Lane 2: primary
Lane 3: PCR squared
Lane 4: B° (62.7 °C)
Lane 5: C° (63.2°C)
Lane 6: D° (63.9°C)
Lane 7: E° (64.7°C)
Lane 8: F° (65.4°C)
Lane 9: G° (65.8°C)
Lane 10: nothing
Lane 1: 1 Kb ladder
Lane 2: I (62°C)
Lane 3: J (61.8°C)
Lane 4: K (61.4°C)
Lane 5: L (60.6°C)
Lane 6: M (59.6°C)
Lane 7: N (58.8°C)
Lane 8: O (58.3°C)
Lane 9: P (58.0°C)
Lane 10: nothing
Lane 1: 1 Kb ladder
Lane 2: Q- (72°C)
Lane 3: R- (71.8°C)
Lane 4: S- (71.4°C)
Lane 5: T- (70.6°C)
Lane 6: U- (69.6°C)
Lane 7: V- (68.8°C)
Lane 8: W- (68.3°C)
Lane 9: X- (68.0°C)
Lane 10: Primary
Lane 1: 1 Kb ladder
Lane 2: Sample S (65°C)
Lane 3: Sample T (65.2°C)
Lane 4: Sample U (65.7°C)
Lane 5: Sample V (66.4°C)
Lane 6: Sample W (67.2°C)
Lane 7: Sample X (67.9°C)
Lane 8: Sample Y (68.3°C)
Lane 9: Sample Z (68.5°C)
Lane 10: Sample A^2 (PCR squared with samples D, E, F, G, from below)
Gene is ~1500 bp
Lane 1: Sample A (62.5 °C)
Lane 2: Sample B (62.7 °C)
Lane 3: Sample C (63.2 °C)
Lane 4: Sample D (63.9 °C)
Lane 5: Sample E (64.7 °C)
Lane 6: Sample F (65.4 °C)
Lane 7: Sample G (65.8 °C)
Lane 8: Sample H (66 °C)
Lane 9: 1 Kb ladder
DNA sequencing results from pNIC-Bsa4 plasmid
NNNNNNNNNGTTNACTTTAGANGAGANATACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGA GAACCTGTACTTCCAATCCATGGAGACCGACGTCCACATATACCTGCCGTTCACTATTATTTAGTGAAATGAGATATTAT GATATTTTCTGAATTGTGATTAAAAAGGCAACTTTATGCCCATGCAACAGAAACTATAAAAAATACAGAGAATGAAAAGA AACAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGATTTTCTATCAAACAAAAGAGGAAAATA GACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGAGGTCGAAAAGTAAATCGCGCGGGTTTGTTACTGATAAAGCAGG CAAGACCTAAAATGTGTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATATTTTAGGTCTTTTTTTATTGTGCG TAACTAACTTGCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACACAGTACATAAAAAAGGAGACATGAACG ATGAACATCAAAAAGTTTGCAAAACAAGCAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGC GTTTGCGAAAGAAACGAACCAAAAGCCATATAAGGAAACATACGGCATTTCCCATATTACACGCCATGATATGCTGCAAA TCCCTGAACAGCAAAAAAATGAAAAATATAAAGTTCCTGAGTTCGATTCGTCCACAATTAAAAATATCTCTTCTGCAAAA GGCCTGGACGTTTGGGACAGCTGGCCATTACAAAACACTGACGGCACTGTCGCAAACTATCACGGCTACCACATCGTCTT TGCATTAGCCGGANATCCTAAAAATGCGGATGACACATCGATTTACATGTTCTATCAAAAAGTCGGNGAAACTTCTATTG ACAGCTNGGAAAACGCTGGNCGCGTCNTTAAAGACAGCGACNAANTCGATGCANTGATNCTATCCTAAAAGACCNAACNN ANANNGNCNGNTCAGCCNCNTTTNCNTCTGANNGAAAATCNNNNTCTACNCTGATTCNNCNGTAANNNTTACNGNAANNA NNNCTGNNACTGNNNNANNNACGNNNNNNNNNTNNNNNCNCTTNAANNTCNNCGNNGNNNNGNATNNNANNNNNNTNNAN GNNNNNNNNANNNNNNNNNNNCNNNNNNCNANNNGNANNNNNNNNNNNNGGNNNNNANNNNNNNNNNNNTNNNNNNNNN
Pairwise Alignment with pNIC-Bsa4
Week 6
The secondary PCR overlap protocol was finished and the samples were prepped and run on an agarose gel the next day for analysis. FPLC of the PfDXR protein was done for further purification of this protein. VS4 was redone again, but this time CONECTs between the metals and other residues were removed. Midi prep of the pNIC-Bsa4 protein was also done and the sample's concentration was determined by Nanodrop and was sent to sequencing. Two more secondary PCRs were done, one with first and last oligos, the seconds with tail primers. Both of these were also run on a gel. The protein samples recovered from the FPLC of PfDXR were spun down and filtered and then analyzed with Nanodrop. The proteins were then stored by both flash freeze and glycerol methods.
The below gel shows the secondary PCR of PfGR done with an annealing temperature of 64 degrees Celsius, the above is at 63 degrees Celsius. The next attempt will be done at 64 degrees since the below image shows some amplification at the appropriate bp length (about 1500 bp).
Week 5
Primer design of the tail primers for our specific targets were done and put on the wish-list for ordering. Then primers for our targets were diluted and stored to run a gel on later. Another culture of pNIC-Bsa4 was grown overnight and spun down and saved in the -20 freezer for midi prep to be done to it later. An oligo mix was made from the 38 primers for the 3D7 glutathione reductase target. From the oligo mix a PCR overlap protocol was done and an agarose gel was run from the primary and secondary samples. The primary sample could be made out on the gel. but not the secondary sample so another primary and secondary PCR overlap was made, as well as another secondary sample from the initial primary sample.
Week 4
Analysis of DNA sequencing of pGBR22 was done in the computer lab in which the forward and reverse primers were determined, as well as the location of the start and stop codon of the specified plasmid and the vector backbone. SDS-Page protein gels were prepared Tuesday for later use on our purified protein. pfDXR protein samples from last week's protein expression were sonicated and then purified. Both elution samples were then analyzed on the Nanodrop spectrometer. The next morning the samples taken from protein purification of pfDXR were run on the SDS-Page protein gel made earlier in the week and was washed and stained. An agarose gel from the pLIC PCR that was redone last week was redone. After washing overnight, the SDS-Page gel was dried for analysis. Restriction enzyme digest was also done and an agarose gel was done for analysis.
Week 3
The PCR of the GFP sample done last week was run on a gel and imaged for analysis. The results from the DNA sequencing of the midi-prepped pNIC-Bsa4 sample were also returned and analyzed. Then two small overnight cultures of BL21(DE3) with FABV plasmid (100 ml LB each) were prepared and left in the shaking incubator overnight. A larger LB flask (500 ml LB) was also prepared to transfer the small culture over the next morning. The next morning the FABV bacteria did not have any growth so protein expression was continued with the pfDXR culture. 30 ml of the pfDXR culture was transferred to a larger culture was checked every 30 minutes until it reach an OD 600 of 0.500 (reached 0.995) and then left in the shaking incubator for approximately 3.5 hours. This culture was then spun down and re-suspended in buffer to be stored in the -80 degrees Celsius freezer. PCR of pNIC-Bsa4 plasmid was done with pLIC primers and the samples were run on an agarose gel and imaged for analysis.
DNA Sequencing results for pNIC-Bsa4
Blast Results for above sequence
The above confirmed the indentity of the pNIC-Bsa4 plasmid and it was transfered to the plasmid box.
Week 2 - A - great work and great page! -- Dr. B
Midi Prep was done on the pNic-BSA4 plasmid sample that was made from the overnight culture last week. Agarose gels of last week's PCR samples were made and analyzed. The first midi prep did not produce a successful sample, so a second culture was made and spun down for a second midi prep to be done. The sample collected from the midi prep was then analyzed using the Nanodrop spectrometer and found to have a concentration of 19.6 ng/ul. A second PCR was done using VDS 1 and 2 primers as well as M13 forward and reverse primers on the GFP plasmid.
Week 1
Primer T7 was diluted to a 10uM concentration. DNA sequencing of pGBR22 plasmid was also done and the results came back with an exact match for the chromoprotein. E.coli cells were transformed with pNic-BSa4 plasmid, and overnight culture was made, and that culture was then spun down and stored for the midi prep protocol. PCR was also done to the same pGBR22 plasmid and the samples were stored in the freezer.
Transformation
Transformation Efficiency Calculations
Plate A: 245
Plate B: 30.4
Plate C: 3.32
DNA Sequencing
pGBR22 plasmid
NNNNNNNNNNNNNGGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTTTAGTGATGGTGATGG
TGATGACCGAGCAAAGAGTGGCGTGCAATGGATATTTCACACTGCTCAACAAATGTGTAATCCTTGTTGTGACTGGTTAC
ATCCAGTTTGCGGTCAACATAGTGATACCCTGGCATCCTCACAGGCTTCTTTGCCTTGTAAGTAGATTTGAATTCACACA
AATAGTAACCACCTCCTTCCAACTTCAGAGCCATAAAGTTGTTTCCTATCAGCATTCCATCTCGTGCAAAGAGACGCTCA
GTGTTGGGTTCCCAGCCCTGTGTCTTCTTCTGCATAACAGGTCCATTGGGAGGAAAGTTCACACCAGAGATTTTGACATT
GTAGATGAAACAGTTGCCTTGGATGCTGGAATCATTGCTGACAGTACACACTGCACCATCTTCAAAGTTCATGATCCTCT
CCCATGTATATCCCTCAGGGAATGACTGCTTTACATAATCAGGGATGTCTTCAGGGTACTTGGTGAATGGTATGCTTCCG
TATTGAGACAGTGGTGATAAAATATCCCAAGCAAATGGCAGAGGTCCACCCTTGGTGACAGTGAGCTTTACCGTCTGCTC
CCCCTCGTAAGGCTTTCCTTTTCCATCGCCTTCGACCTCAAAGTAGTGTCCATTGACCGTGCCTGACATATAAACCTTGT
AGGTCATTTGTTTAGCGATCACACTCATGATATTTCTCCTTCAATCAATCAAAATCACTAGTGCGGCCGCCTGCAGGTCG
ACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCA
TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAA
AGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTNNNAAANCTGTC
NTGNCAGCTGCATTAATGAATCGGCNACNNNCGGGGNANNNGNNGTTTGCGTANTGNNNCTCNTCCGNTNCNCGCTCANT
GANTCNNNNNNCTCNNNCNNNCGGCNNCNGNNNNNNNGNNTCANCNNNNNNNNNNGNNNGNNNNNNNNNTNNNCCNNNNN
NNNGNNNNNACNNNGAANANNNNNNNNNNNNNNCNAANGCNNNNNNNNNAAAGNCNNNNNNNNNNNNNNNNNNTNNNNNN
Blast Results (top match)
Quantifying DNA**